faren87 faren87

21-09-2022
Mathematics

contestada

Rory has 6 pounds of ground beef to make meatballs. He uses 5/8 pound per meatball to make 9 meatballs. How many 1/8 pound meatballs can Rory make with the remaining beef?

Respuesta :

Otras preguntas

which is greater? -7 or -8

Two of the dozen eggs in a carton are cracked. About what percent of the carton is cracked?

A sample of 86 motels is selected from a large urban area and the price for a night of lodging for a single room was determined for each motel. The mean rate is

Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I

(2(4²)(-3)) ² x 3(4) (-3)

given l || m || n, find the value of x.

Five years ago, Deepika was twice as old as Kanchan. Five years later, Deepika's age will be 5 more than Kanchan's age. Find their present ages.

what is required in the physical theatre

i need a code that can be execute in xv6

In the Excel document, you will find the 2018 data for 17 cities in the data set Cost of Living. Included are the 2018 cost of living index, cost of a 3-bedroom