megansueholliday megansueholliday
  • 22-02-2024
  • Mathematics
contestada

A 3 year loan for $3,000, with a monthly payment of $89.24, is paid at the end of 2 years. What is the savings for this early pay-off?

Respuesta :

Otras preguntas

The Iron Curtain A. Was built by the Soviets across the border between East Germany and Poland. B. Was the first of many physical barriers built across Eastern
Tip Top Corp. produces a product that requires 14 standard gallons per unit. The standard price is $6.00 per gallon. If 3,500 units required 51,000 gallons, whi
A curve ball is a type of pitch in which the baseball spins on its axis as it heads for home plate. If a curve ball is thrown at 33.1 m/sm/s (74.0 mphmph) with
describe five advantages of artificial classification​
what is the value of gravitational constant​
I was wondering if anyone could answer this :)
What is the difference between national income and personal income? Multiple Choice Personal taxes. National income includes income earned both in the United St
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provid
HELPP PLEASEEE thanks!
2. Do you agree with the results of Schenck's case? Why or why not?help plzzz