kickle7984 kickle7984

24-05-2018
Mathematics

contestada

what expression is equivalent to -2(-3t-1)-(t+3)

Respuesta :

27-05-2018

[tex]-2(-3t-1)-(t+3)=-2(-3t)-2(-1)-t-3=6t+2-t-3=5t-1[/tex]

Answer Link

Otras preguntas

how does each of the listed molecules cross the cell membranes water fructose oxygen carbon dioxide

Which settlement does the colored region of the map depict? New Spain in 1750 New France in 1750 New France in 1500 New Spain in 1763

PLEASE!! Which phrases describe faults? Check all that apply. are cracks in Earth’s crust cause gaps in the geologic record cause rocks to break and move are yo

!!PLEASE ANSWER ASAP!! you put a screw in a wall stud with a screw driver. then you put a screw in the wall with an electric screw driver. which of the follow

What are some common things people do for a living in this period of time like jobs

DNA tacaggtacccgaacccaattta

Can someone please help me the question 6? I really need help

A hollow, transparent plastic tube is placed on a horizontal surface. A wire carrying a current is wound once around the tube to form a circular Loop in The Wir

This is a simple biological process not requiring oxygen.

Consider the sequence of steps to solve the equation: 2(x − 4) + 6x = 9x − 10 Which step in solving this equation is justified by the Commutative Property of Ad