richard3215 richard3215

24-07-2018
Mathematics

contestada

which of the following numbers is irrational 9-5 .√5.√9

Respuesta :

Plasmataco Plasmataco

24-07-2018

its sqrt(5) since sqrt(5) isn't a whole number(its like 2.23)

Answer Link

Otras preguntas

A cylinder has a height of 18 feet. Its volume is 16,334.28 cubic feet. What is the radius of the cylinder?

All of the following are functions of the nervous system except.

4 Correct Drag each label to the correct location on the image. Name the stages of the water cycle. condensatio 17 precipitatiom SIT evaporation runoff Free gro

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

which term is defined by the interaction between two charged particles?

Why the body needs more water after exercising/performing rigorous activity

£2000 is invested in a bank with 3% interest per annum. work out the amount of money in the account after 2 years

Can someone help me out with this please

The original triangle and its projection are similar. What is the missing length n on the projection?

“Agriculture is a source of food and raw materials for industries”.Justifyy