desireefaith7896
desireefaith7896 desireefaith7896
  • 24-09-2018
  • Health
contestada

the weight lifting bar weighs _____ pounds?

Respuesta :

brauliocvega713
brauliocvega713 brauliocvega713
  • 24-09-2018

i believe your answer is 45 pounds

Answer Link

Otras preguntas

a soccer ball reaches it's maximum height 13 feet, 3 seconds after it's kicked. Which of the following quadratic could model the height of the soccer ball over
Help!! does x = 2?? An equation is shown below: 4(2x - 5) + 15 = 11 Write the steps you will use to solve the equation and explain each step.
S toddlers (ages 1–3 years) begin to explore their world, they learn that they can control their actions and act on the environment to get results. what is the
which statement best defines civil rights
What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt
The level of CO2 emissions, f(x), in metric tons, from the town of Fairfax x years after they started recording is shown in the table below.
Question 3 Unsaved Which type of mine involves digging tunnels and shafts deep underground? Question 3 options: strip mine smelting openpit mine subsurface min
what is the greenhouse effet. Why is the greenhouse effect so important to life on Earht
The American Civil Libert union influences government policies by
What are the areas of the body that can be used to obtain body temperature?