rayzariem rayzariem
  • 26-10-2018
  • English
contestada

which bestd identifiy the character trait of peter van daan

Respuesta :

Fortniterlz
Fortniterlz Fortniterlz
  • 26-10-2018
Reserved

Hope this helps
Answer Link
cmmancl
cmmancl cmmancl
  • 26-10-2018

Quiet, Timid, Sweet, and Honest :)

Answer Link

Otras preguntas

Stories can be told well in movies, but the best way to tell a story is in the pages of a novel. Novelists can develop characters fully and sustain readers' sus
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
Henry and Jose are gaining weight for football. Henry weighs 205 pounds and is gaining 2 pounds per week Jose weighs 195 pounds and is gaining 3 pounds per week
if f(x)=-x+2 find f(6)
¿crees que el estado nación mexicano pudo haberse conformado de una manera distinta de tal manera que en la actualidad perteneciéramos a los países de primer mu
What has to be broken before you can use it?​
How many moles are in 50 g of CO2
Tom, Kristen, and bill bought 3 granola bars to share amongst themselves. They divided each granola bar into 4 equal portions. Kristen ate 1 portion from each g
Becky belongs to a culture in which arriving early is thought to be impolite. What would a conventionalist call this action in Becky's culture
PLS HELP ME I DON'T GET IT