arthurwhyte arthurwhyte
  • 23-04-2019
  • Geography
contestada

Dorsal consonants are?:

A) Accent among natives

B) French Speakers

C) Mid-tongue pronounced letters

D) Russian language branches

Respuesta :

Einsteinhelp
Einsteinhelp Einsteinhelp
  • 23-04-2019

C) Mid-Tongue pronounced letters

Answer Link

Otras preguntas

The shift from agriculture to industrialization illustrates that __________. A. land has become scarce B. economies change over time C. society has become more
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Frank uses improper body position to lift a heavy box and strains the muscles in his lumbar region. which muscles are most likely to be involved in this injury?
1+4=5 2+5=12 3+6=21 8+11=
How can one concentrate in studies ?
What is the power output of an electric motor that lifts a 2.0 kilogram block 15 meters vertically in 6.0 seconds
2. How does Oliver violate the rules of the workhouse?
I need help with this. thank you!
the volume of a sphere is 950 cubic inches. Use the formula for the volume of a sphere to find the radius to the nearest tenth of an inch
The Glorious Revolution of 1688 demonstrated that Parliament had