rediet37 rediet37
  • 25-06-2019
  • Mathematics
contestada

How to did a volume of a cylinder

Respuesta :

heatherswiffin666
heatherswiffin666 heatherswiffin666
  • 26-06-2019

Base x height

To find the base, do pi r squared.

Answer Link

Otras preguntas

Chromatin condenses into chromosomes, and spindles begin to form.
This US poster from the World War I era BEST illustrates that
Identify and describe six different ways the legislative and executive branches can check une power of the Supreme Court and the judicial branch.
Jack spent $54 on Jersey that was on sale for 10% off. what was the original price?
what is the the union for the following sets. X = {0, 10, 100, 1000} Y = {100, 1000} X ∪ Y =
Speculate as to how the information obtained from the sequencing of the human genome might be used to someday eliminate inborn errors of metabolism
Janice attempted to shoot 34 free throws with a basketball. She made 19 of 1 point the free throws. Based on those results what would you estimate the probabili
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
A wheel which is initially at rest starts to turn with a constant angular acceleration. After 4 seconds it has made 4 complete revolutions. 1)How many revolutio
Which quadrilaterals have four congruent sides? A. rectangle, rhombus B. square, parallelogram C. trapezoid, rectangle D. square, rhombus