carterT5 carterT5

24-09-2019
Mathematics

contestada

what the answer tonthis question 10x=-4(2x-9)

Respuesta :

desthermitcrab desthermitcrab

24-09-2019

10x = 4(2x -9)

10x = 8x - 36

10x - 8x = -36 - 8x

2x = -36

2x ÷ 2 = -36 ÷ 2

x = -18

If you need a better explanation just as in the comments.

Happy to help! Please mark as BRAINLIEST! Thanks

Answer Link

Otras preguntas

I need help with this. thank you!

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Juliana’s exercise partner is running a high fever and feels nauseous. She also has a rapid heart rate. What should Juliana do? Get warm food Stay in the sun

Which name does the monk who travels to the west not use

What is 7 3/4 times 7?

Explain the relationship between osmosis and aquaporins.

If 60 is 75% of a value, what is that value?

Meaning of highland cow

What two cell types do complement proteins interact with, besides the pathogen itself?

what happened when citric acid and and bicarbonate soda mixed together