beanlovesjesus beanlovesjesus
  • 23-05-2016
  • Chemistry
contestada

I have to write a 150 word paragraph or two that describes at least three everyday things that exist or occur because of science. I also have to make sure i use examples. I don't have a clue where to start ??? PLEASE help!

Respuesta :

MDude
MDude MDude
  • 23-05-2016
You can do something like natural disasters and explain why they happen
Answer Link

Otras preguntas

45. What is the wovelength of a 30. Hertz periodic wave moving ol 60. meters per second? a. 0.50m c. m b 20m d 1800 m
How to graph a linear function from slope-intercept form
How are the causes of mudslides and erosion different
What is the temperature shown on the thermometer?
1) According to the global ecological footprint by nation, which country likely has the smallest (per capita) reliance on non-renewable resources? es A) USA B)
rotate point B about point F 288 degrees clockwise
how much power is needed to lift a box with a force of 780 newtons over a distance of 2 meters in 45 seconds
Help help help help
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
Find the values of x and y.