makdadaget makdadaget

22-04-2020
Biology

contestada

Where does gas exchange occur between the blood and tissues?

Respuesta :

yenysegurays yenysegurays

06-05-2020

jjj

idk

Explanation:

vete al hospital porque me voy de la casa nunca se me olvido

Answer Link

Otras preguntas

please translate to spanish; sheep live from 10 to 11 years.

The life span at birth of humans has a mean of 88.37 years and a standard deviation of 18.88 years. Calculate the upper and lower bounds of an interval containi

URGENT PLZZZZZZZZZZZZZZZZZZZZZ BRAINLIEST FOR WHOEVER ANSWERS FIRST how did reconstruction affect race relations in the united states

Money given to the states by the federal government are..? -Money orders -Bonds -Grants -Loans

A vehicle goes from 5 m/s to 50 m/s in seconds. What is it’s acceleration?

The Triple L investment club is considering purchasing a certain stock. After considerable research, the club members determine that there is a 70% chsnce of ma

If you saw this strand of DNA how many base pairs would be in thestrand?aagcttctgaatcagttcgaagacttagtc

Why did the Japanese restore the Meiji emperor to power after the Harris Treaty opened Japan to foreign trade?

A compound contains only carbon, hydrogen, nitrogen, and oxygen. Combustion of a 2.18 g sample burns in excess oxygen yields 3.94 g of CO2 and 1.89 g of H2O. A

Finnish Motors has the following balance sheet accounts: Land $ 150,000 Equipment 90,000 Salaries Payable 12,000 Notes Payable 99,000 Supplies 10,000 Cash