luvxmimi luvxmimi

23-04-2020
Biology

contestada

Create the complement of the following DNA strand. TACCCATTACGCGGCAAGCGUAATTAC

Respuesta :

Аноним Аноним

23-04-2020

Answer:

This is the mRNA strand

Explanation:

AUGGGUAAUGCGCCUUCGCAUUAAUG

Answer Link

StephanyNo StephanyNo

23-04-2020

AUGGGUAAUGCGCCGUUCGCAUUAAUG

Answer Link

Otras preguntas

Write your own moral for the fable “the shepherds boy and the wolf “

$4. Is what percent of $100.

A gardener plants two types of trees in a park: Type A is five feet tall and grows at a rate of 12 inches per year. Type B is three feet tall and grows at a r

One mole of a chemical element contains approximately 6.02 × 1023 atoms. How many atoms are present in 4.6 × 104 moles of oxygen? Represent the answer in scient

Need help with solving systems of equation

Julie tried to use the law of syllogism to draw a conclusion based on the statements below. Explain why she is not able to do so. If AB is bisected by another

HELPPPP!!!! Suppose that I have $300 in a bank account with 2% interest compounded every year. how much money will I have in my account after 6 years? (Round

the magnet below is cut in half. what will be the result?

What is the function of ‘relay nerves’?

Suppose that you invest $400 in a bank account that has APR of 6% and it is compounded monthly (12 times a year) How much money will you have in your account af