diamondlouisebai
diamondlouisebai diamondlouisebai
  • 25-04-2020
  • English
contestada

write 150 words to your friend who gave you the best gifts ever​

Respuesta :

tansyshaj2004
tansyshaj2004 tansyshaj2004
  • 25-04-2020
Thx it was amazing I loved it so much
Answer Link

Otras preguntas

Cardiac muscle contracts A. in response to voluntary output B in response to nonvoluntary input C. on its own without input
Which transition word would a writer use to indicate a conclusion to a text? A: finally B: despite C: although D: however
1+4 = 5. 2+5=12. 3+6=21 8+11==?
blank thousands equals 1800 tens
Dree rolls a strike in 6 out of 10 frames of bowling. What is the experimental probability that Dree will roll a strike in the first frame of the next game? Exp
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Which transition word would a writer use to indicate a conclusion to a text? A: finally B: despite C: although D: however
of the 600 workers at a factory, 8.5% belong to a union. how many workers are in the Union?
jon eat 3/4 of a pizza how much pizza is left
E. coli (K12) has a genome size of 4,639,675 bp in one chromosome that encodes for 4,435 proteins. The average size of these proteins is 330 amino acids. What p