johnnymax johnnymax

26-04-2020
History

contestada

In which amendment was alcohol banned?

Respuesta :

bry0513 bry0513

26-04-2020

Answer:

The Twenty-first Amendment

Answer Link

critesma4605101225 critesma4605101225

26-04-2020

Answer:

The 21st amendment

Explanation:

The Twenty-first Amendment (Amendment XXI) to the United States Constitution repealed the Eighteenth Amendment to the United States Constitution, which had mandated nationwide prohibition on alcohol.

Answer Link

Otras preguntas

The market for new homes is in equilibrium. New homes are a normal good for consumers. If a recession reduces consumers' incomes at the same time that the price

When do all locations on earth experience equal lengths of day and night?.

can someone help me w this asap PLEASEEE

(pls help, thank you <3) Human cells have 46 chromosomes. Each chromosome consists of a pair of identical chromatids attached together by a structure called

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT

A rectangular array is shown below. Use the array to write equivalent expressions in the form

Please help. I already asked once but the answer isn't right. Pic is attached... how do I find the value of x?

Name the type of volcano illustrated in diagram A and describe how it forms.

Solve 8²- (10÷ 2 x 3) Step by steps

What is the length of the longest side of a right triangle if the two shorter sides are 50 cm and 120 cm?