helenirby1964 helenirby1964
  • 22-05-2020
  • Chemistry
contestada

4. Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Please

Respuesta :

FortniteforLifeooof FortniteforLifeooof
  • 22-05-2020

Answer:

AUUUAAAHAHYAGHY

Explanation:

Answer Link

Otras preguntas

Can you please give me thesis statements about Battle of Brooklyn.
Most photosynthesis occurs in the ____________________ of the plant. a. stem c. seeds b. leaves d. roots
Make a sentence for the word tectonics.
In 5-10 sentences, describe the purposes, design considerations, and common elements of most brochures.
How can you make a magnet that turns on and off
Can someone please help me think of a creative tittle for the Battle of Brooklyn.Thank you!!! :)
What did Spain do after the American Revolution to discourage American settlements west of the Appalachian Mountains?
is embellish and adorn the same thing?
A theory should be able to explain the relevant data and lead to correct predictions. a. True b. False
what was the Loyalist perspective of the navigation acts