nabdi19 nabdi19
  • 27-05-2020
  • English
contestada

1. What do the presence of fish and a wide diversity of invertebrates in a river indicate

Respuesta :

Eden0701
Eden0701 Eden0701
  • 27-05-2020

Answer:

Good ecosystem

Explanation:

It means there's good biodiversity in the environment

Answer Link

Otras preguntas

a dime is flipped and a six-sided die is rolled what is the probability of flipping heads and rolling an odd number
Circle the preposition in these sentences We were exhausted because our flight arrived at 4am.
What is the vapor pressure of water at 750C?
What hormones are related to sodium balance?
which of the following was a justification for the increase in US defense spending during the Cold War
Marley has read 112.5 pages of a book. By the end of today, she plans to have read at least a total of 360 pages. If she reads 45 pages per hour, what is the mi
On Monday Harold picked up four donuts and two large coffees for the office staff. He paid 4.08. On Tuesday Melinda picked up two donuts and three large coffees
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Emily buys 4pens for £1 how much would 7 pens cost ?
Who discovered polio vaccine