montgomerybunston montgomerybunston

22-09-2020
Biology

contestada

a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Respuesta :

oceanbluewater3000 oceanbluewater3000

22-09-2020

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

Answer Link

Otras preguntas

Emma sings into a microphone. The sound is transferred from the microphone to a loudspeaker that is plugged into the wall. Her voice comes out of the loudspeake

How did the Agricultural Adjustment Act of President Roosevelt's "New Deal" aid Georgia's farmers? A. It gave price supports for farmers to grow less cotton.

The sum of 3 times the value of x and 2 is equal to 4 less than 5 times the value of x. Witch equation can be used to find the value of x?

Taking away a persons ability to vote is referred as

What are 5 main characteristics of mineral?

How many sipreme court justices are there

2. Kim is x years old. Jordan is 7 years older than Kim. Four times Jordan’s age is equal to 200. (a) Write an equation that could be used to solve for Kim’s a

Plz help and put these words in ABC order tysm btw the words are disapprove dishonest disobey dismount discomfort disconnect discolor

Transverse and longitudinal waves both

ZX bisects ∠WZY. If the measure of ∠YXZ is (6m – 12)°, what is the value of m? A. 6 B. 17 C. 90 D. 102