cmvancamp1122 cmvancamp1122

21-10-2020
English

contestada

Add the suffix to the root, creating a new word.
due + -ly

Respuesta :

sarbear97 sarbear97

21-10-2020

Is it duly? I don't really know, I'm just trying to help.

Answer Link

Аноним Аноним

22-10-2020

Answer: due + -ly = duly

Explanation:

Answer Link

Otras preguntas

Which of the following best describes a business code of ethics?

Art can give information about all of the following except.

Can you help me? See picture below.

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

In which region would an archaeologist be most likely to find evidence of roman roads?.

Find the perimeter and area of the polygon shown below

Two atoms of element Q mixed with element E

Can someone help me with this please

Philip has $5,774 in a savings account. The interest rate is 13%, compounded annually. To the nearest cent, how much interest will he earn in 5 years? (compound

can someone help me figure this out