taehyung1st
taehyung1st taehyung1st
  • 23-10-2020
  • World Languages
contestada

what is the meaning of tangina?​

Respuesta :

Аноним Аноним
  • 23-10-2020
Tangina is a Filipino slang for an offensive word. It is a swear word that means, “your mom is a whooore”.
Answer Link

Otras preguntas

Water and minerals can follow three pathways to the vascular tissue of the root. Describe the three pathways.
Juliana’s exercise partner is running a high fever and feels nauseous. She also has a rapid heart rate. What should Juliana do? Get warm food Stay in the sun
what feature of a confederal system did the confederate states of america most want
Discuss the consequences of poor wound management.
How would your study of early China have been different if you were studying 100 years ago?
f(x)= 3/x+2-square root x-3
On Monday Harold picked up four donuts and two large coffees for the office staff. He paid 4.08. On Tuesday Melinda picked up two donuts and three large coffees
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Consider the following piecewise-defined function. f(x){x^2 -5, x<3
Please explain how to find area of the rectangle pyramid.