Kadeejahdockery32 Kadeejahdockery32

25-11-2020
English

contestada

what type of questions is "you shouldn't have done this to me
is it complex,compound or simple?

Respuesta :

Rahilaattiq Rahilaattiq

25-11-2020

Answer:

It is maybe simple

Explanation:

Answer. ↪This sentence is a simple sentence. Complex sentence is contained with two or more finite verbs or clauses which are linked with binders (who,which,that,as etc.)

And I think this answer is from Brainly

Answer Link

tiara3480 tiara3480

25-11-2020

Answer:

It is a simple sentences

Answer Link

Otras preguntas

A right triangle has legs that measure 8 cm and 10 cm. What would the length of the hypotenuse be to the nearest whole number?

the surface area of a rectangular prism

Can anyone explain why my account got banned for no reason? Has this happened to u?

what type of reaction is Fe(NO3)3 + 3NaOH → Fe(OH)3 + 3NaNO3

True or False of the three states of matter, molecules in solids have the greatest freedom of motion.

x-3y = -15 . . 2x+y=5

What percentage of the population in Thailand has an occupation in agriculture?

what s the equation of the line that passes through the points (1,8) and (-2,-7)?

Write the expression using only positive exponents. Assume no denominator equals zero. 4y^-2 Answers: none of these -8y^2 1/4y^2 16y^2 4/y^2

transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC