tamarianwestbrook tamarianwestbrook

22-02-2021
Social Studies

contestada

Heat and pressure can change limestone into marble. Marble is a(n):
igneous rock
conglomerate rock
sedimentary rock
metamorphic rock

Respuesta :

boohoont boohoont

22-02-2021

Answer:

metamorphic

Explanation:

Answer Link

Otras preguntas

Each of the 4 children in a family drinks 24 ounces of milk every day. how much milk do the children drink in one week (7days)

What is the best way to start a presentation when trying to sell a product? Thx!

Hedgehogs prepare for winter by eating a lot of food and building nests. In the winter, they become mostly inactive. How does this adaptation help the hedgehog

please help me thanks!

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT

HELP PLEASE HELP ME! ( no links -_-)

Find the perimeter of the polygon. Please help

-Hana's parents decidedthat she should marry. Hanna's parents decided that sheshould Marry early. However, Hana does not want to marry before She completes her

Tell whether the angles are adjacent or vertical. Then find the value of x.

PLS HELP ASAP What made Joan of Arc a hero to the French? (4 points) A. She turned people toward the Catholic Church while she was jailed. B. She unified the pe