gulnora85 gulnora85

22-02-2021
English

contestada

What was the most important lesson you have ever learned in your life?

Respuesta :

ajpetermann123 ajpetermann123

22-02-2021

Answer:

Slow down—don't rush into things. Let your life unfold. Wait a bit to see where it takes you, and take time to weigh your options. Enjoy every bite of food, take time to look around you, let the other person finish their side of the conversation

Answer Link

kiwiduck kiwiduck

23-02-2021

I have learned to not take things for granted. Live in the moment. Before you know it anything could happen and it’s all taken away from you. Sorry if that’s too sad.

Answer Link

Otras preguntas

A single stranded DNA has a base sequence of 5'GACTCCGTAACGGTTAACC3'.What DNA sequence will base pair

Which Of The Following Can Be Found In Breast Milk? 1. Vitamin D 2. Calcium 3. Anti Bodies 4. Iron

Describe two ways in which bacteria and the fungus Penicillium are similar? Describe two ways in which bacteria and the fungus Penicillium are different?

Where can the resource for this ocean type be found?

which of the following are solutions to the equation below? check all that apply. x^2+6x+9=6 A. x=3+√6 B. x=3-√6 C. x=3 D. x=0 E. x=-3+√6 F. x= -3-√6

If 1+4=5 and 2+5=12 what does 8+11=

1.What process is used to replicate the chromosomes? 2.Are the sister chromotids genetically identical? Explain.

Which of the following statements about tuberculosis is FALSE? A.It usually affects the digestive tract. B. It responds to a long course of antibiotic treatment

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Marley has read 112.5 pages of a book. By the end of today, she plans to have read at least a total of 360 pages. If she reads 45 pages per hour, what is the mi