kimloves40 kimloves40

23-02-2021
Mathematics

contestada

Maria's coin collection contains three nickels for every 30 dimes.If Maria has 630 dimes,how many nickels does she have.

Respuesta :

annieflvs annieflvs

23-02-2021

Answer:

Maria has 63 nickels

Answer Link

randomuser777 randomuser777

23-02-2021

Answer:

63 nickels

Step-by-step explanation:

630/30=21

21*3=63

Answer Link

Otras preguntas

For the function Rx) = 1/x+1 which of these could be a value of F(x) when x is close to -1 O A. -0.01 OB. 0.01 O c. 1 O D. -10,000

if x=8 and y=-3 evaluate 7(2x-3y)

A financial institution that makes short-term, high-interest loans to borrowers who are considered high risk is a:A. credit union.B. retail bank.C. mortgage len

Theresa is considering starting a small business. She plans to purchase equipment costing $145,000. Rent on the building used by the business will be $26,000 p

The domain, range, and x-intercept of a one-to-one function are shown. domain: 1 > 2 range: y > -3 x-intercept: (11,0) Which set of information could be c

The fable "Why the Sun Is Brighter Than the Moon” is important to its culture because it reveals

Which statements describe organic compounds

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provid

select the expression that is equivalent to (x-7)

i would like help in this question