fayegibbo
fayegibbo fayegibbo
  • 26-02-2021
  • Mathematics
contestada

Mr. Jackson divided £420 between his children in the ratio of their ages, Mitch is 4 and Jo is 3

Mr Jackson divided 420 between his children in the ratio of their ages Mitch is 4 and Jo is 3 class=

Respuesta :

26jains 26jains
  • 26-02-2021

Answer:

Mitch=60*4=240

Jo=60*3=180

Step-by-step explanation:

420/7=60

Answer Link

Otras preguntas

What is a vestigial organ
Does “actions speak louder than words” refer to leadership, mentoring, or teaching by example?
help answer ASAPPP 10 points
1+4=5 2+5=12 3+6=21 8+11=?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
A parking lot in the shape of a trapezoid has an area of 12,052.1 square meters. The length of one base is 82.4 meters, and the length of the other base is 108.
PLEASE HELP ME AASSAPP
Imagine a situation in which the number of urea leak channels increased dramatically in the ascending limb of the loop of Henle. What could be one likely conseq
Chloe’s mother wants to have another child. However, she is concerned that a second child might also have CF, so she encourages Chloe’s stepfather to be tested.
Which of the following examples would be classified as a dependent clause? A. whirling through the yellow-colored sky B. the mile-wide black tornado roared C.