melissamontemayor melissamontemayor

23-03-2021
Mathematics

contestada

Where should 0.3 be placed in the ven diagram??
A: natural
B: integers
C: rational
D: real numbers

Respuesta :

shane4085 shane4085

23-03-2021

It would be placed in rational

Answer Link

Otras preguntas

If you are caught speeding in a school or construction zone you’re fine will________

A game has a deck of cards with 10 red cards, 4 blue cards, and 2 yellow cards. You randomly choose two cards. Find the probability of choosing two red cards an

Ay increase by more than 170% to meet the body's increased o2 demands. this increase in cardiac output increases blood pressure. but the accompanying increase i

What two literary terms are used in the song lyrics below? *For the first time in forever*, there’ll be music, there’ll be light. For the First time in Forever

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

The _______ amendment places substantial limits on the use of deadly force.

If a hexagon has a side length of 10 what is the area of the hexagon?

describe fascism and how it took root in Italy

What is 30007592639+-7936373926

List 5 different programming languages calls to print