kevonbennett14 kevonbennett14

26-03-2021
History

contestada

who was Queen Isabella?

Respuesta :

4318230 4318230

26-03-2021

Answer:

Isabella I was Queen of Castile from 1474 and, as the wife of King Ferdinand II, Queen of Aragon from 1479 until her death, reigning over a dynastically unified Spain jointly with her husband Ferdinand; together they would be known as the Catholic Monarchs.

Explanation:

Answer Link

Otras preguntas

A number tripled and tripled again is 729 what is the number

What's x² + 2x + 1 factorised?

I only need to know the answers to numbers 9 and 10 The problems are the ones circled in the photo

Which of the following statements about tuberculosis is FALSE? A.It usually affects the digestive tract. B. It responds to a long course of antibiotic treatment

1+4=5 2+5=12 3+6=21 8+11=

Imagine a situation in which the number of urea leak channels increased dramatically in the ascending limb of the loop of Henle. What could be one likely conseq

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Explain which one of the above market control measures is applicable in the Labour market and justify why it is important to consider the effects of such action

. The production of fatty acids is dependent on bicarbonate, but radioactive bicarbonate is not incorporated into the new fatty acid. What could be the reason f

State two biological reasons why you consider that the loss of biodiversity matters.