tanyasingh21
tanyasingh21 tanyasingh21
  • 26-03-2021
  • Biology
contestada

Help me plz asap 2-4 plz

Help me plz asap 24 plz class=

Respuesta :

annaclaire946
annaclaire946 annaclaire946
  • 26-03-2021

Answer:

1.mRNA- ATGAAAAGGTCCGTGGGAACTAAACAACACTAA

2.MRNA- ATGAAAACGGTCCGTGGGAACTAAACAACACTAA

3. ??

4. It will affect the protein so the leg wont have enough protein or have too much.

Explanation:

Answer Link

Otras preguntas

Which of the following is a way to get full benefit of your schooling
The length of a rectangle is 8 m more than 6 times the width. The perimeter is 156 m. Find width.
Which type of question geospatial technology help geographers to answer? Which question cannot be answered with geospatial technology
A bike wheel is 26 inches in diameter. What is the bike wheel's diameter in millimeters (1 inch = 25.4 millimeters)?
Bon rules relating to good professional character and unprofessional conduct are intended to
The _____ provides the voice of the storyteller and guides the reader through the events of the story.
what is the surface area in square inches of a cube with a side 7 inches long?
what is the total number of colonists to arrive at Jamestown by summer of 1609
What are some steps that scientists can take in designing an experiment to avoid false negatives?
Which philosopher believed that the soul operated on three levels: reason, will, and desire?