Analeysi09 Analeysi09
  • 22-07-2021
  • Biology
contestada

Fill in the bottom line of DNA with the complementary base pair:

Fill in the bottom line of DNA with the complementary base pair class=

Respuesta :

ramasahadev ramasahadev
  • 22-07-2021

Answer: ACCTGATCGTAGCT

Explanation:

Keep in mind that in DNA replication, the matching base pairs are A and T (adenine and thymine) and C and G (Cytosine and Guanine). This means that for DNA complementary strands, A's can ONLY bind with T's and C's can only bind with G's , and vice versa. So, your answer for the picture you have given is ACCTGATCGTAGCT

Answer Link

Otras preguntas

The chorionic villi of the placenta develop a series of capillaries that are immersed in lacunae of the mother's blood for exchange into the embryo's blood duri
Find the smallest zero for the function h(x) = 4x^2 - 8x - 60
Pedro tapes a 3 5/6 piece of paper to a 2 3/4 inch of piece with no overlap. how long is the piece of paper he made?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
What hormones are related to sodium balance?
What impact did Babe Ruth have on the society/country?
which of the following is a general way to describe the base pairing rules for DNA
help me please ,,,,,,,,ex 6 ,pleaseeee
PLEASE HELP ME AASSAPP
How can global warming lead to changes to the Earth’s surface? a. Global warming can lead to an increased number of earthquakes, which change the Earth’s surfac