castilloesperanza399
castilloesperanza399 castilloesperanza399
  • 21-09-2021
  • Mathematics
contestada

solve the equation below
x-7=13
x=?​

Respuesta :

djtwinx017
djtwinx017 djtwinx017
  • 21-09-2021
x - 7 = 13

Add 7 to both sides of the equation:

x - 7 + 7 = 13 + 7

x = 20
Answer Link
naynaluquin0410 naynaluquin0410
  • 21-09-2021
I believe the answer is 20
Answer Link

Otras preguntas

1. Obligate anaerobes are often grown in an anaerobe jar, which completely excludes oxygen from the environment. How is the environment within a tube of fluid t
Derek is deciding what to wear to school. He has a green shirt, a purple shirt, and a red shirt, and he has beige, gray, and blue pants. He also has sandals, ru
Lee used her computer for 60 minutes on Friday. On Saturday, she used her computer for 150% of the number of minutes she used it on Friday. What was the number
What hormones are related to sodium balance?
What happens as genes are passed on from parent to offspring over many generations?
a speech is considered what type of text
what does beowulf offer hrothgar as a prize
Does this represent a linear function?
physical components are connected to a cpu via the motherboard in all the following ways except
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC