GlowingPie44 GlowingPie44

25-09-2021
Physics

contestada

Can anyone help me, please answer this question properly...

Can anyone help me please answer this question properly class=

Respuesta :

kholoudhash kholoudhash

25-09-2021

Answer:

1) The students were messy.

2) The voters were intrested in the election.

3) Tom was hurrying.

4) It was hot.

5) The horse was excited.

Explanation:

Answer Link

Otras preguntas

Which of the following ideas best fits with biological evolution by natural selection? 1.The most fit individuals are those with the highest reproductive succes

John Locke would have agreed with all of the following statements EXCEPT:

Imagine a situation in which the number of urea leak channels increased dramatically in the ascending limb of the loop of Henle. What could be one likely conseq

im making a poster for chemistry. the topic is acid and base. i have to make a creative title to go with the poster. any ideas?

Why it is not possible to draw a square that is not a parallelogram

the surface of water connect like a sort of sort of skin due to property of liquids called

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Does this represent a linear function?

Multiple sclerosis is a demyelinating disease in which the patient's immune system attacks and destroys the cells that form the myelin sheath in the central ner

a dime is flipped and a six-sided die is rolled what is the probability of flipping heads and rolling an odd number