MiraculousNisha MiraculousNisha

23-10-2021
Business

contestada

what do you mean by Producer's Equilibrium ?????

Respuesta :

paulian4532 paulian4532

23-10-2021

Answer:

it is refered to as profit maximization condition

Answer Link

oODemonSlayerOo oODemonSlayerOo

30-10-2021

Answer:

it is refered to as profit maximization condition

It's ne Lilly unnie

Answer Link

Otras preguntas

what procedure could you use to test the effect of a catalyst on a reaction

which of the following expressions is equal to 1? a. 5^0 x 6^-3 x 6^3 x 5^1 b. 5^2 x 6^-2 x 6^3 x 5^-3 c. 5^2 x 5^-2 x 6^0 x 6^2 d. 5^-1 x 6^5 x 6^-5 x 5

analyze how heat transfer occurs during the processes of conduction and convection.

find three acids and three bases used in your home. 1) what are theses acids and bases used for? 2)look up the chemical name and chemical formula of each acid a

Use these words in a sentence proton neutron and isotope

14. Which of Canada's Atlantic Provinces has jurisdiction over mainly uninhabited Labrador?

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

1. Explain the different forms of child abuse? Include Shaken Baby Syndrome in your response.

1. The chart below shows changes in the length of a tree's shadow during a sunny day. (5.2.D) LENGTH 8:00 AM 2 meters 9:00 A.M. 1 meter 10:00 A.M. 0.5 meter 12:

an object is launched upward from ground level and reaches a maximum height of h feet. The initial velocity v (in feet per seconds) of the object is given by th