wannisa
wannisa wannisa
  • 24-10-2021
  • Social Studies
contestada

Which country riches​

Respuesta :

KidSwee
KidSwee KidSwee
  • 24-10-2021

Answer:

We might think USA is ranked number 1. However USA is at rank #8! But looking at the GDP per capita, Luxembourg is #1. Okay, okay... I know you are thinking, where is the WORLD is this country at? Luxembourg is a small European country, surrounded by Belgium, France and Germany. Population is only 629,191 people, but the GDP per capita is Int$ 118,359.5 (that is a lot). Yeah so Luxembourg!! That is your number 1!

Explanation:

Answer Link

Otras preguntas

What is the effect of using scaffold proteins on precision and amplification capacity in cell signaling?
Lee used her computer for 60 minutes on Friday. On Saturday, she used her computer for 150% of the number of minutes she used it on Friday. What was the number
What does the equation -355-n=-957 what does n equal?
Convert 2x - 3y + 1 = 0 to slope-intercept form
what two Georgians signed the united states constitution
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
calculate the perimeter of a quadrilateral 3 cm 2 cm 2 cm 5 cm
Lee used her computer for 60 minutes on Friday. On Saturday, she used her computer for 150% of the number of minutes she used it on Friday. What was the number
how many atoms are present in 4.0 mol of sodium
why did the united states fail to join the league of nations