s8841505
s8841505 s8841505
  • 22-01-2022
  • Mathematics
contestada

Someone plz help meh

Someone plz help meh class=

Respuesta :

xenia168
xenia168 xenia168
  • 23-01-2022

Answer:

f( g ( - 2 ) ) = - 14

Step-by-step explanation:

f(x) = - 2x + 4

g(x) = 3x² - x - 5

f( g ( - 2 ) ) = ?

g( - 2 ) = 3( - 2 )² - ( - 2 ) - 5 = 12 + 2 - 5 = 9

f(9) = - 2 × 9 + 4 = - 14

f( g ( - 2 ) ) = - 14

Answer Link

Otras preguntas

what adjective best describe mr white
What advantage does binocular vision provide for primates?
If two coins are tossed togehter what is the probability of having at most one head
the sum of two number is 14 and their difference is 10 then what will be their multiplication
Las personas de origen______son el grupo hispano más grande en los EE.UU.
Can someone help me find the area cause I forgot how to find the area of triangles.Also, the question mark is 12.
Mycorrhiza from a relationship between fungi and which part of vascular plants
DNA tacaggtacccgaacccaattta
A skeletal muscle is a composition of several components bundled one into the other. At which structural level in the muscle does contraction occur to bring abo
Apparently people who go blind early in childhood are on average better at identifying musical notes by ear than are sighted people. Nonessential or essential?