Seudónimo Seudónimo

24-01-2017
Mathematics

contestada

Is it possible to have an expression that uses brackets without using any parentheses???Explain.help plz

Respuesta :

trentonnl88 trentonnl88

24-01-2017

yes it is possible if it doesn't have parentheses

Answer Link

Otras preguntas

What is a major event in the passage above? OA. Alice falls down a rabbit-hole without knowing where it ends. OB. Alice peeps into the book that her sister is r

can i have some help :

Which number sentence is true? OA) 5.6 > |-8.91 OB) |-5.6] < |-8.91 OC) -5.6 > 1-8.91 OD 15.6] > 1-8.91

Type a digit that makes this statement true. 61,587,72 is divisible by 5. HELPPPPPPP PLZZZZZZZZZZZZZZ!!!!!!!!

the point in the sky directly above your head at any given time is called the

Need help on True or False PLEASE answer!!!!

Hannah plans to spend 1/4 of her next month's income on rent, 1/12 on transportation, 1/6 on food, $520 on other expenses, and save $875. How much does she pla

difference between associative and commutative property

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

Cancer is subject to evolution due to: Question 25 options: A) Gene flow B) Tumor cells experiencing a bottleneck event due to chemotherapy C) Natural selection