ashleymcombs1016 ashleymcombs1016

22-06-2022
Chemistry

contestada

If aluminum has a density of 2.7 g/cm³, what is the volume of 2.7 grams of aluminum?

Respuesta :

xsneezeyx xsneezeyx

22-06-2022

Answer:

Solution Density of aluminium = 2.7 g/Cm 3 In kg/ m 3 = 27 × 1000 10 =2700 kg/ m 3

Explanation:

Not much of one

Answer Link

Otras preguntas

Which set of angle measures can be the angle measures of a triangle? A 31°, 60°, 90° B 18.4°, 32.6°, 129° C 125°, 25°, 40° D 10°, 120°, 40°

could someone please help me with these

find vertex of: y=(x-4)(x+8)

If your country and your enemies country both had nuclear weapons, would you fire them at each other? Why or why not?

A restaurant is hosting a dinner event for a maximum of 95 people. So far, 23 people have registered to attend the event. There are 12 tables let and each table

Shaheem has $100 at most to spend on socks and sneakers. He finds a pair of sneakers that he likes for $85. If socks are $3 per pair, how many pairs could Shahe

3. What were the civil war strategies of the two sides?

2. You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’. template DNA 3’ CCTACGGTTCGTACCCCGTA

Why does darkness affect the light-independent reactions of photosynthesis

help meh please and thnk you