gjb33745 gjb33745

23-06-2022
Mathematics

contestada

Which number best represents a debt of $5,324?
A.
-53,240
B.
-5,324
C.
5,324
D.
53,240

Respuesta :

Аноним Аноним

23-06-2022

Answer:B

Step-by-step explanation:The negative represents how the debt is in the negatives so it should be B. I hope that helps!

Answer Link

ronniecarmona2006 ronniecarmona2006

23-06-2022

The answer is B cause it’s a negative amount

Answer Link

Otras preguntas

Irving drove 200 miles to Worcester in 256 hours. What was his average speed, in miles per hour?

Which of the following statements does not describe the members of the Roman Senate? A. They could declare war. B. They could veto laws. C. They could appoint d

PLEASE HELP ASAP!!!!!! A. Explain what makes this set of data a function B. What could cause this set of data to not be a function? Give specific example to su

DNA tacaggtacccgaacccaattta

I need 1-5. Please help!!!

What is 13379.11 divided by 3?

a horse pulls out 6000 J of work traveling 300 m . what is the force used ?

Which form of estar is incorrect? (2 points) Select one: a. Yo no estÃ¡ en la casa. B. TÃº estÃ¡s muy contenta. C. Ellos estÃ¡n cansados. D. Nosotros estamos en

The amount of energy it takes to life a box might be a function of which of the following ??

which type of formatting technique would you use to break up information into smaller chunks? A. Charts. B. Italics. C. Bullet points. D. Underlining.