ttj3948
ttj3948 ttj3948
  • 25-07-2022
  • History
contestada

state how agrarian revolution in USA in America

​

Respuesta :

milespalmer milespalmer
  • 27-07-2022

Answer:

It involved a dramatic shift from pre-industrial mechanized production, handicrafts, and cottage industry, to factory production and mass-customization

Explanation:

could you click the crown at the bottom of the answer? it gives me brainlyest. I have 1,014 points, but I need the crowns

Answer Link

Otras preguntas

what is the solution to the following equation? 9x^2-12x+4=17
what is 0+50×1-60×0+10=
In a Worn path by Eudora welty in lines 1-9 what details suggest that phoenix is in for a long journey?
What is the answer to 8xsquared-24x
(Does this represent a linear function) (3,6)(0,2)(3,5)
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Consider the combustion of octane (C8H18) 2C8H18+25O2-> 16CO2+18H2O How many grams of CO2 are produced when 191.6g of octane are burned?
Pythagorean Theorem: Alex leaves home, travels 5 miles east, and arrives at the library. He leaves the library and travels 3 miles north to a friend's house.
A major cause for gender inequality is believed to be (Points : 1) economic division of labor by gender. political leadership. women’
Can anyone help? My teacher just briefly went over this in notes and I can't really decipher between physical and chemical changes in the examples