AaliviaS1942 AaliviaS1942

25-10-2022
Mathematics

contestada

Identify the degree and leading coefficient of the given power function

Identify the degree and leading coefficient of the given power function class=

Respuesta :

ZyaireZ790009 ZyaireZ790009

25-10-2022

[tex]ax^n[/tex]

In a equation as above:

a is the leading coefficient

n is the degree

For the given equation:

[tex]-2x^2[/tex]

The coefficient is: -2

The degree is: 2

Answer Link

Otras preguntas

Compared to mitosis, meiosis results in greater... A)amount of cell cytoplasm per cell B)number of daughter cells per cell C)amount of genetic material per cell

Which of the following can increase your credit cards APR

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

I need somebody's help..

What is the source Code of transcription

The heart sounds S1 and S2 are...?

Eleven members of the Middle School Math Club each paid the same amount for a guest speaker to talk about problem solving at their math club meeting. They paid

How would your study of early China have been different if you were studying 100 years ago?

calculate the perimeter of a quadrilateral 3 cm 2 cm 2 cm 5 cm

Pseudomonas syringae is found naturally in the soil. Sold as Snomax, it is used to make snow at ski resorts. The same bacterium with a gene deletion (Ice-minus)