Fufu2323 Fufu2323
  • 24-03-2017
  • Health
contestada

Blood pressure tends to be temporarily higher when people

Respuesta :

ShaveTheWhales
ShaveTheWhales ShaveTheWhales
  • 24-03-2017
Your blood pressure will increase temporarily when you are stressed.
Answer Link
itsveronicaab
itsveronicaab itsveronicaab
  • 24-03-2017
Among the known causes of secondary hypertension, kidney disease ranks highest. Hypertension can also be triggered by tumors or other abnormalities that cause the adrenal glands (small glands that sit atop the kidneys) to secrete excess amounts of the hormones that elevate blood pressure.
Answer Link

Otras preguntas

If 1+4=5; 2+5=12; 3+6==21; what is 8+11
The shift from agriculture to industrialization illustrates that __________. A. land has become scarce B. economies change over time C. society has become more
Why wood suitable to build boats and rafts
What did Anti-Federalists fear would happen if the Constitution became law?
which one of the statements is true
How are vibrations different between bigger sizes rubber bands and smaller sized rubber bands?
Factor 3s+27t. Please help me I was absent for about a week with a high fever when she taught this lesson. I'm on 73% on IXL so PLEASE HELP!
What's x² + 2x + 1 factorised?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Explain lt Explain why the formula for finding the surface area of a rectangular prism is helpful. I NEED HELP !