kaaykaayduh3
kaaykaayduh3 kaaykaayduh3
  • 25-08-2017
  • History
contestada

Most ancient people tended to be ?

Respuesta :

Roksy1995
Roksy1995 Roksy1995
  • 25-08-2017
most ancient people tended to be polytheistic
Answer Link

Otras preguntas

what number should be added to the expression to turn it into a perfect square trinomial x^2+2x
what other fields of the study might contribute to knowledge and understanding in art history?
What are the three differences between The Quran and the Gospel??
1. Explain the different forms of child abuse? Include Shaken Baby Syndrome in your response.
Joe has eaten of a pizza. Jane has eaten of a pizza How many times more pizza has Joe eaten than Jane?
How can global warming lead to changes to the Earth’s surface? a. Global warming can lead to an increased number of earthquakes, which change the Earth’s surfac
Water and minerals can follow three pathways to the vascular tissue of the root. Describe the three pathways.
What are two adjectives for the word Black hawk?
87.5 of what number is 315
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC