genmclark2002owormj genmclark2002owormj

22-09-2017
Mathematics

contestada

through : (1,2), prep. to y=- 1/6x - 3

Respuesta :

Аноним Аноним

22-09-2017

Perpendicular means the slope is reciprocal and opposite sign...

y = 6x - 4 is the answer

Answer Link

Otras preguntas

What are the odds in favor of rolling two number cubes and having a 7 on the first roll and doubles on the second roll? please give an explanation

A car is driving at 45 kilometers per hour. How far, in meters, does it travel in 5 seconds?

Determine two coterminal angles (one positive and one negative) for each angle. Give your answers in radians. (Enter your answers as a comma-separated li 3π/4

If a DNA sample consists of 30% Thymine, what are the percentages of the other bases? Adenine Thymine Cytosine Guanine If a DNA sample contains 66% Guanine, wha

Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I

What relationships are shown in the Figure 2 model?

The visible spectrum of sunlight reflected from Saturn's cold moon Titan would be expected to be continuous. emission spectrum. absorption spectrum.

The table below shows the amounts of cooked rice that can be made using different amounts of dry rice. Based on the information in the table, how many cups of c

8 more than negative 10

Use a protractor to measure the angles in the figures which segment is an angle bisector