ally587246 ally587246
  • 22-03-2021
  • Mathematics
contestada

Can someone help me with these two please-

Can someone help me with these two please class=

Respuesta :

Crxxom Crxxom
  • 22-03-2021

Answer:

a. 405/4

b. 1/32

Step-by-step explanation:

a. (5x8 + 5) / 8 x 18

= 45/8 x 18

= 405/4

b. 3/8 ÷ 12

= 3/8 x 1/12

= 1/32

Answer Link

Otras preguntas

At Super Grocery, strawberries cost $3.00 for 2 pounds. What is the unit price per pound of strawberries? 6 dollars per pound 6 strawberries per dollar O 1.50 d
summary of Matilda Cook
A company's relevant range of production is 10,000 to 15,000 units. When it produces and sells 12,000 units, its unit costs are as follows: Amount per Unit Dire
At what temperature will water change from a liquid to a solid?
The U.S. counties that border Mexico have an unusually high percentage of people in which age group?
Read the excerpt from "George Washington." Which is the central idea in this excerpt? He realized early that the best strategy was to harass the British. He re
WILL MARK BRAINLIEST Use the chemical equation to complete the activity. 2Cu+S→Cu2S Copper (Cu) reacts with sulfur (S) to form copper sulfide as shown in the ch
a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
Choose the function that has domain X /= -1 range y /=2
how can you determine if a relation represented as an equation is a function? explain your reasoning​